View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_high_26 (Length: 267)
Name: NF20011_high_26
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 5472850 - 5472708
Alignment:
| Q |
10 |
attattctgtaaattggcacacagacttcaatcttgatttgaacatatgtatctacttatatttcacaacattcctttcgaagaattaaagattctatcg |
109 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5472850 |
attattctgtaaattggctcatagacttcaatcttcatttgaacatatgtatctacttatatttcacaacattcctttcgaagaattaaagattctatcg |
5472751 |
T |
 |
| Q |
110 |
gttgatgatacctctaagatcactttccctaggcttgttagaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5472750 |
gttgatgatacctctaagatcactttccctaggcttgttagaa |
5472708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University