View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_low_21 (Length: 309)
Name: NF20011_low_21
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 263
Target Start/End: Original strand, 41364199 - 41364449
Alignment:
| Q |
12 |
ataggaggagagtacaacactgcgaggggtcgtatgtttttacacttttcaatttcaatcaattattagttcgtgctattctttgatttccaatcaaaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41364199 |
ataggaggagagtacaacactgcgaggggtcg-atgtttttacacttttcaatttcaatcaattattagttcgtgctattctttgatttccaatcaaaga |
41364297 |
T |
 |
| Q |
112 |
gtcttgagacgacatcttttgcacactgtagtatagagtctatgctatatcaatcaattaccagtaagattgtgtaggcttggatgaatcaggatactta |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41364298 |
gtcttgagacgacatctttttcacactgtagtatagagtctatgctatatcaatcaattaccagtaagattgtgtaggcttggatgaatctggatactta |
41364397 |
T |
 |
| Q |
212 |
taatactcaaggagctcatgccatgcaatattgttcaattttatgttgggga |
263 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41364398 |
taatactcaaggagcccatgccatgcaatattgttcaattttatgttgggga |
41364449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 293
Target Start/End: Original strand, 41364528 - 41364557
Alignment:
| Q |
264 |
ttcacgcaaactgcatgtaatggagataat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41364528 |
ttcacgcaaactgcatgtaatggagataat |
41364557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University