View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_low_33 (Length: 242)
Name: NF20011_low_33
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 42083550 - 42083777
Alignment:
| Q |
1 |
ccaacaaccggaaagccggctagaacaccattgctcatgcacttttccaatcctttaaaaaccccagtataatgaattcttctggaagtgcttcttcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42083550 |
ccaacaaccggaaagccggctagaacaccattgctcatgcaattttccaatcctttaaaaaccccagtataatgaattcttctggaagtgcttcttcttt |
42083649 |
T |
|
| Q |
101 |
gattttattctcaaatttgtatccactacttgggtccatgggttcaaaatgtatggtttattgaacacatacctcacttctgtgacttcagaaatgcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42083650 |
gattttattctcaaatttgtatccactacttgggtccatgggttcaaaatgtatggtttattgaacacatacctcacttctgtgacttcagaaatgcttt |
42083749 |
T |
|
| Q |
201 |
ccctatagtttgcttggggagcaccaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42083750 |
ccctatagtttgcttggggagcaccaac |
42083777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 145
Target Start/End: Original strand, 42087070 - 42087209
Alignment:
| Q |
4 |
acaaccggaaagccggctagaacaccattgctcatgcacttttccaatcctttaaaaaccccagtataatgaattcttctggaagtgcttcttctttgat |
103 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||| |||| |||||||||||||| |||||||| |||| |||||| ||||| |||| || ||||||| |
|
|
| T |
42087070 |
acaactggaaatccggccagaacaccattgctcatacactcttccaatcctttaacaaccccag--gaatgtattcttttggaactgctcctcctttgat |
42087167 |
T |
|
| Q |
104 |
tttattctcaaatttgtatccactacttgggtccatgggttc |
145 |
Q |
| |
|
|| | ||| |||| |||||||||| ||| ||||| ||||| |
|
|
| T |
42087168 |
ttcactcttgaattcatatccactacctggctccattggttc |
42087209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 42087289 - 42087326
Alignment:
| Q |
191 |
gaaatgctttccctatagtttgcttggggagcaccaac |
228 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
42087289 |
gaaatgctttccctgtagtttacttggggagcaccaac |
42087326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University