View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20011_low_34 (Length: 242)

Name: NF20011_low_34
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20011_low_34
NF20011_low_34
[»] chr3 (1 HSPs)
chr3 (39-227)||(48955668-48955856)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 39 - 227
Target Start/End: Original strand, 48955668 - 48955856
Alignment:
39 agggttgaggttggaggtgatgaataggaacagaaccagaatgaaagcaatttcatgtggtaatggaatttgacagaaagatgagtgagcacgcagaggc 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
48955668 agggttgaggttggaggtgatgaataggaacagaaccagaatgaaagcaatttcatgtggtaatggaatttgacagaaagatgagtgagcacgcaaaggc 48955767  T
139 aacgatatacatctataccgagtgtctgtgtgctcactctcttctgtcaatttctatgttccaatgatgagcaaaaacaagatggttat 227  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48955768 aacgatatacatctataccgagtgtctatgtgctcactctcttctgtcaatttctatgttccaatgatgagcaaaaacaagatggttat 48955856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University