View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_low_34 (Length: 242)
Name: NF20011_low_34
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 39 - 227
Target Start/End: Original strand, 48955668 - 48955856
Alignment:
| Q |
39 |
agggttgaggttggaggtgatgaataggaacagaaccagaatgaaagcaatttcatgtggtaatggaatttgacagaaagatgagtgagcacgcagaggc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48955668 |
agggttgaggttggaggtgatgaataggaacagaaccagaatgaaagcaatttcatgtggtaatggaatttgacagaaagatgagtgagcacgcaaaggc |
48955767 |
T |
 |
| Q |
139 |
aacgatatacatctataccgagtgtctgtgtgctcactctcttctgtcaatttctatgttccaatgatgagcaaaaacaagatggttat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955768 |
aacgatatacatctataccgagtgtctatgtgctcactctcttctgtcaatttctatgttccaatgatgagcaaaaacaagatggttat |
48955856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University