View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20012_low_19 (Length: 242)
Name: NF20012_low_19
Description: NF20012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20012_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 3077501 - 3077596
Alignment:
| Q |
1 |
attacttgattttgtacacagattttgcactagcccgacaccagtgaattatcaaattttaaatataaagagaagggatctttttattgaattcaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3077501 |
attacttgattttgtacacagattttgcactagcccgacaccagtgaattatcaaattttaaatataaagagaagggatctttttattgaattcaa |
3077596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 228
Target Start/End: Original strand, 3077908 - 3078017
Alignment:
| Q |
119 |
gttctgacctcgaaaagactacgatgtcaattgaatgtgatannnnnnnattcataggtgtttatttggagttgatggcatatcctaggaatgaatgtat |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3077908 |
gttctgtcctcgaaaagactacgatgtcaattgaatgtgatagttttttattcataggtgtttatttggagttgatggcatatcctaggaatgaatgtat |
3078007 |
T |
 |
| Q |
219 |
tgacgattct |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
3078008 |
tgacgattct |
3078017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 37 - 108
Target Start/End: Complemental strand, 36511181 - 36511110
Alignment:
| Q |
37 |
gacaccagtgaattatcaaattttaaatataaagagaagggatctttttattgaattcaacggaaaactgta |
108 |
Q |
| |
|
|||| ||||||| || |||||| ||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36511181 |
gacatcagtgaactaccaaattctaagtataaagagaagggatctttttattgaattcaatagaaaactgta |
36511110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 39297212 - 39297171
Alignment:
| Q |
1 |
attacttgattttgtacacagattttgcactagcccgacacc |
42 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39297212 |
attacttgattttgtacacagattttgtactagcccgacacc |
39297171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University