View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20013_high_10 (Length: 286)
Name: NF20013_high_10
Description: NF20013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20013_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 134 - 280
Target Start/End: Original strand, 2114653 - 2114800
Alignment:
| Q |
134 |
atctattgctattgttagagctgcggtgcagtggcttagttacaggctcggtatcatttcaaatgcattagaagtgaactgcagactgcagtggtggtgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2114653 |
atctattgctattgttagagctgcggtgcagtggcttagttacaggctcggtatcatttcaaatgcattagaagtcaactgcagactgcagtggtggtgt |
2114752 |
T |
 |
| Q |
234 |
ttacttagttcaatggatgtttgttctgtggtcac-tgatgatgtcca |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2114753 |
ttacttagttcaatggatgtttgttctgtggtcacgtgatgatgtcca |
2114800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 28 - 135
Target Start/End: Original strand, 2114249 - 2114353
Alignment:
| Q |
28 |
caaagagaacaacacaaaagataaaatatcat-aaaattttaaaaaagaaccagtcatattcttacaatatataattccataacaatgttctttttggga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2114249 |
caaagagaacaacacaaaagataaaatatcataaaaattttaaaaaagatcgagtcatattcttaca----ataattccataacaatgttctttttggga |
2114344 |
T |
 |
| Q |
127 |
tgttattat |
135 |
Q |
| |
|
||||||||| |
|
|
| T |
2114345 |
tgttattat |
2114353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University