View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20013_high_11 (Length: 270)
Name: NF20013_high_11
Description: NF20013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20013_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 2 - 135
Target Start/End: Original strand, 30816445 - 30816578
Alignment:
| Q |
2 |
tttagtataattttgactcaacaccttctcttccttctatgttatgacacacattatggatcataggaaacaataaaaatattctgtctttgaaataaat |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30816445 |
tttagtataattttaactcaacaccttctcttccttctatgttatgacacacattatggatcataggaaacaataataatattctgtcttcgaaataaat |
30816544 |
T |
|
| Q |
102 |
ttagttgacaaaaggcacaaggtatagaaatctg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30816545 |
ttagttgacaaaaggcacaaggtatagaaatctg |
30816578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 197 - 254
Target Start/End: Original strand, 30816640 - 30816697
Alignment:
| Q |
197 |
tcaggaagcaagcacgtgtctgtgaagtaaaagtgatgaatgaatttggtgcatagtg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30816640 |
tcaggaagcaagcacgtgtctgtgaagtaaaagtgatgaatgaatttggtgcatagtg |
30816697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 197 - 254
Target Start/End: Original strand, 30804870 - 30804927
Alignment:
| Q |
197 |
tcaggaagcaagcacgtgtctgtgaagtaaaagtgatgaatgaatttggtgcatagtg |
254 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804870 |
tcaggaagcaagcacgtgtctgggaagtaaaagtgatgaatgaatttggtgcatagtg |
30804927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 94 - 135
Target Start/End: Original strand, 30804767 - 30804808
Alignment:
| Q |
94 |
aaataaatttagttgacaaaaggcacaaggtatagaaatctg |
135 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
30804767 |
aaataaattttgttggcaaaaggcacaaggtatagaaatctg |
30804808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University