View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20013_high_12 (Length: 264)
Name: NF20013_high_12
Description: NF20013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20013_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 19153797 - 19153586
Alignment:
| Q |
18 |
attataatgctttaaacaatgtccaaaaaacactcattaacattctctttcaaatttctcttnnnnnnnn--cattctcattcaaattaaattgcactaa |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
19153797 |
attataatactttaaacaatgtccaaaaaacactcattaacattctctttcaaatttcacttaaaaaaaaaacattctcattcaaattaaattgcactaa |
19153698 |
T |
 |
| Q |
116 |
aaatttactcttttttctgataaatcagtgtcctagattgaatgttagaaatttctaattgataccgtacactacaagaaataacgcatttcctttgaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19153697 |
aaatttactcttttttctgataaatcagtgtcctagattgaatgttagaaatttctaattgataccgtacactacaagaaataacacatttcctttgaaa |
19153598 |
T |
 |
| Q |
216 |
acaagtgaattc |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19153597 |
acaagtgaattc |
19153586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University