View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20013_high_15 (Length: 203)
Name: NF20013_high_15
Description: NF20013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20013_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 47 - 184
Target Start/End: Complemental strand, 7340405 - 7340268
Alignment:
| Q |
47 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagnnnnnnnnatagtagctagctagtgtgttagagtta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7340405 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagttttttttatagtagctagctagtgtgttagagtta |
7340306 |
T |
 |
| Q |
147 |
aatgtgtccaattgatgtactttttataggtgatgaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340305 |
aatgtgtccaattgatgtactttttataggtgatgaat |
7340268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University