View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20014_low_5 (Length: 235)
Name: NF20014_low_5
Description: NF20014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20014_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40383362 - 40383272
Alignment:
| Q |
1 |
tctcatcgtcgtcgacgccgggtgccggccaatcgcggaagagatggtcttggccattgttcaatagtatcttcaccaactcttgctgatt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383362 |
tctcatcgtcgtcgacgccgggtgccggccaatcgcggaagagatggtcttggccattgttcaatagtatcttcaccaactcttgctgatt |
40383272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 40383213 - 40383148
Alignment:
| Q |
156 |
aggaacctgtttcggggagagaaggttgaaattgtcgccgagggaggaagccatggtggaattgag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383213 |
aggaacctgtttcggggagagaaggttgaaattgtcgccgagggaggaagccatggtggaattgag |
40383148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University