View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20014_low_5 (Length: 235)

Name: NF20014_low_5
Description: NF20014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20014_low_5
NF20014_low_5
[»] chr3 (2 HSPs)
chr3 (1-91)||(40383272-40383362)
chr3 (156-221)||(40383148-40383213)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40383362 - 40383272
Alignment:
1 tctcatcgtcgtcgacgccgggtgccggccaatcgcggaagagatggtcttggccattgttcaatagtatcttcaccaactcttgctgatt 91  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40383362 tctcatcgtcgtcgacgccgggtgccggccaatcgcggaagagatggtcttggccattgttcaatagtatcttcaccaactcttgctgatt 40383272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 40383213 - 40383148
Alignment:
156 aggaacctgtttcggggagagaaggttgaaattgtcgccgagggaggaagccatggtggaattgag 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40383213 aggaacctgtttcggggagagaaggttgaaattgtcgccgagggaggaagccatggtggaattgag 40383148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University