View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20015_low_10 (Length: 239)
Name: NF20015_low_10
Description: NF20015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20015_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 45818914 - 45818700
Alignment:
| Q |
7 |
aggagcagagaggaaatcgacgcatgattttctgtcgctatacagtaattcaactgccgaacaagatccaaggccatctgctcaaggtactgtataattt |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818914 |
aggagcagggaggaaatcgacgcatgattttctgtcgctatacagtaattcaactgccgaacaagatccaaggccatctgctcaaggtactgtataattt |
45818815 |
T |
|
| Q |
107 |
gnnnnnnnnnnnnnggttattattatgcaaaatgattcggtgtgtgagatttttctttcctatgttgttgccatgnnnnnnnctctgacgtggggatcat |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
45818814 |
gttttttaatttttggttattattatgcaaaatgattcggtgtgtgagatttttctttcctatgttgttgccatgtttttttctgtgacgtggggatcat |
45818715 |
T |
|
| Q |
207 |
ggtgcaaacctaaat |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45818714 |
ggtgcaaacctaaat |
45818700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University