View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_15 (Length: 406)
Name: NF20016_high_15
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 41864134 - 41863891
Alignment:
| Q |
18 |
gctgtcactctcatcactgctactgccactgtcactgttgtgaccggatacgccatccttcatcctctggaacatgttgtttctcttgtgctccctccta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864134 |
gctgtcactctcatcactgctactgccactgtcactgttgtgaccggatacgccatccttcatcctctggaacatgttgtttctcttgtgctccctccta |
41864035 |
T |
 |
| Q |
118 |
tttcttccttggcatttcacagcagtggtggtgccagtagcaaaggtagtgccggtagcagcatgattgtggcgtgtttggttgcaattgttagtttgat |
217 |
Q |
| |
|
||||||||||||||| || || |||||| ||| |||||||||||| ||||| |||||||| |||| || || ||||||| |||||||||||| |
|
|
| T |
41864034 |
tttcttccttggcatgtc---gccgtggtgttgctagtagcaaaggtggtgccagtagcagcgtgatggttgc------ggttgcatgtgttagtttgat |
41863944 |
T |
 |
| Q |
218 |
gtttggcaacatgccctggttgataaatcacctccgtttggctatagcattgg |
270 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
41863943 |
gtttggcaacatgccctggctgataaatcacctctgtttggctatagtattgg |
41863891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 265 - 380
Target Start/End: Complemental strand, 41863871 - 41863753
Alignment:
| Q |
265 |
cattggcgtggcgattgtggcgccctcc---tccgaacaagtcagtaaccttgtgtccaattgagctatgctgctgctgctggtgttggttttcctgttg |
361 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
41863871 |
cattggcgtggcgattgtggtgccctccaagtccgaacaagtcagtaaccttgcgtccaattgagctatgctgctgctggtggtggtggtttttctgttg |
41863772 |
T |
 |
| Q |
362 |
gcagctttgttcacaggtt |
380 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41863771 |
gcagctttgttcacaggtt |
41863753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University