View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_24 (Length: 370)
Name: NF20016_high_24
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 24048158 - 24047807
Alignment:
| Q |
1 |
tcatcaatgtatttcttaaggttgtcatcccataacttgtaattcccttcattgagagaatatattttccctgatttcggtatttggagattttcttgag |
100 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24048158 |
tcatcgatgtatttcttcaagttgtcatcccataacttgtaatttccttcattgaaagaataaattttccctgattttggtatttggagattttcttgag |
24048059 |
T |
 |
| Q |
101 |
tcaaaacaaattctccatacattggatctaatgtgaatacgaaaactcctttgccgattgttagaacaaagattactgagctagagtacatgcagtaacc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
24048058 |
tcaaaacaaattccccatacattggatctaatgtgaatacgaaaactcctttgccgattgttagaacgaagattactgagctagaatacatgcagtaacc |
24047959 |
T |
 |
| Q |
201 |
agctgctagaaggttgcttcctggttggcacacatttacaatgcatcgttgttcttctgtgccaagctgcaatttacat-tgta-ttgtgttaaacagtg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| || |
|
|
| T |
24047958 |
ggctgctagaaggttgcttcctggttggcacacattcacaatgcatcgttgttcttctgtgccaagctgcaatttacatatgtatttgtgttaaacaatg |
24047859 |
T |
 |
| Q |
299 |
ttttaaaaatcggactggagatcaaattggtgagacttttcgatcatggttc |
350 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
24047858 |
ttttaaaaattggcctggaaatcaaattggtgagactttccgatcatggttc |
24047807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University