View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_31 (Length: 331)
Name: NF20016_high_31
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 33220054 - 33219891
Alignment:
| Q |
64 |
cttcgtgttttaagaaggaatatggtgaagatggaaggttgattttaaaggtggggaaagtgaagcgttattatgagcatatggaagcgaatcgagaaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33220054 |
cttcgtgttttaagaaggaatatggtgaagatggaaggttgattttaaaggtggggaaagtgaagcgttattatgagcatatggaagcgaatagagaaaa |
33219955 |
T |
|
| Q |
164 |
tggtaggctcatcgtgaagctcatccatcatgatgacgatgatggatggcccatggatgatgac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33219954 |
tggtaggctcatcgtgaagctcatccatcatgatgacgatgatggatggcccatggatgatgac |
33219891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 252 - 308
Target Start/End: Complemental strand, 54472059 - 54472003
Alignment:
| Q |
252 |
aaaagacaccctggttcggaggcaatggtgagttgttaggtggagcctgtgatgact |
308 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472059 |
aaaagacaccctggtttggaggcaatggtgagttgttaggtggagcctgtgatgact |
54472003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 33220111 - 33220074
Alignment:
| Q |
1 |
aggtttttccaccggcgataacgttgttgagagaaacc |
38 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33220111 |
aggtttttccagcggcgataacgttgttgagagaaacc |
33220074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University