View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_46 (Length: 265)
Name: NF20016_high_46
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_46 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 40085862 - 40085588
Alignment:
| Q |
1 |
aacaagatacagtggtaatcatttatttaatttgtgaaatttaatatat--------gtat--aatagagtaactcagcttgaagttatctgtcgtgtaa |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085862 |
aacaagatacagtggtaatcatttatttaatttgtgaaagttaatatgtataataaagtattaaatagagtaactcagcttgaagttatctgtcgtgtaa |
40085763 |
T |
 |
| Q |
91 |
cttaagcttccctacagaagctgctaataatacagctagctgtccattttctttatctatattaagggccctagctctaattgccaatttttgaagtaat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
40085762 |
cttaagcttccctacagaagctgctaataatacagctagctgtccattttctttatctatattaagggccctaactctaattgccattttttgaagtaat |
40085663 |
T |
 |
| Q |
191 |
cttgaaacatgacnnnnnnngataagagcaaaggaagcaaactcaccaggcacatgaaggcacccttaaggttcc |
265 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40085662 |
cttgaaacatgacaaaaaaagataagagcaaaggaagcaagctcaccaggtacatgaaggcacccttaaggttcc |
40085588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University