View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_57 (Length: 248)
Name: NF20016_high_57
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 28625052 - 28625280
Alignment:
| Q |
1 |
caaagtatgacgctttctaagtgtttctctcactctggacccactcatgcaataccggtttctgggttggttgaatctggtgaagtagagtctcttgtcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28625052 |
caaagtatgacgctttctaagtgtttctctcactctggacccacttatgcaataccggtttctgggttggttgaatctggtgaagtagagtctcttgtcg |
28625151 |
T |
 |
| Q |
101 |
tggtttcgttttataagtttgcggatttccctgatcatgctgttttgcgtgtgcccttgaagcaattatgtcaacaattggtattgcattcctttcttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28625152 |
tggtttcgttttataagtttgcggatttccctgatcatgctgttttgcgtgtgcccttgaagcaattatgtcaacaattggtattgcattcctttcgtta |
28625251 |
T |
 |
| Q |
201 |
tctttatttgatgaaattatgattattct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28625252 |
tctttatttgatgaaattatgattattct |
28625280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University