View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20016_high_67 (Length: 236)

Name: NF20016_high_67
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20016_high_67
NF20016_high_67
[»] chr7 (1 HSPs)
chr7 (16-236)||(38358449-38358669)


Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 38358669 - 38358449
Alignment:
16 gttcttgtgggagatattgtgtctctcaagattggtgatcaaattccggctgatggagtatttttatccggttattcgttgcaagtggacgaatctagca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38358669 gttcttgtgggagatattgtgtctctcaagattggtgatcaaattccggctgatggagtatttttatccggttattcgttgcaagtggacgaatctagca 38358570  T
116 tgacaggtgagagcgaccatgtagagattgagcctttaagagctccttttttgttgtccggcgcaaaagttgtggatggatatgctcagatgcttgtaac 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38358569 tgacaggtgagagcgaccatgtagagattgagcctttaagagctccttttttgttgtccggcgcaaaagttgtggatggatatgctcagatgcttgtaac 38358470  T
216 atctgtgggcaaaaacacatc 236  Q
    |||||||||||||||||||||    
38358469 atctgtgggcaaaaacacatc 38358449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University