View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20016_high_70 (Length: 227)

Name: NF20016_high_70
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20016_high_70
NF20016_high_70
[»] chr4 (2 HSPs)
chr4 (102-180)||(40208870-40208948)
chr4 (1-35)||(40209016-40209050)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 102 - 180
Target Start/End: Complemental strand, 40208948 - 40208870
Alignment:
102 catgctaatgaaatcaaactcatacagaccagactaactaaatattctcacacttcacatccacatgggcagagtgctt 180  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40208948 catgctaattaaatcaaactcatacagaccagactaactaaatattctcacacttcacatccacatgggcagagtgctt 40208870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 40209050 - 40209016
Alignment:
1 gattttgatggtcggggaatcatcaaatcatagta 35  Q
    |||||||||||||||||||||||||||||||||||    
40209050 gattttgatggtcggggaatcatcaaatcatagta 40209016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University