View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_high_71 (Length: 226)
Name: NF20016_high_71
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_high_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 9988320 - 9988499
Alignment:
| Q |
14 |
aaaataaagtaatcaccaaccaaccttagaaatgttgcatgcacaaacattaggaatcatttacttatgtgtagcaatatgcagcatgctcaaacaataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988320 |
aaaataaagtaatcaccaaccaaccttagaaatgttgcatgcacaaacattaggaatcatttacttatgtgtagcaatatgcagcatgctcaaacaataa |
9988419 |
T |
 |
| Q |
114 |
caatattgtttctctctttttaagtcaaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988420 |
caatattgtttctctctttttaagtcaaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaa |
9988499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University