View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_31 (Length: 346)
Name: NF20016_low_31
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 16 - 135
Target Start/End: Complemental strand, 49841690 - 49841571
Alignment:
| Q |
16 |
agatttacatttgttgggattcattcccacactttactccagtatatgataaagtcggagaccctttatttttcaaaagaaatagtaaaagattttactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49841690 |
agatttacatttgttgggattcattcccacactttactccagtatatgataaagtcggagaccctttatttttcaaaagaaatagtaaaagattttactt |
49841591 |
T |
|
| Q |
116 |
atagtgagataaatacattc |
135 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49841590 |
atagtgagataaatacattc |
49841571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 159 - 307
Target Start/End: Complemental strand, 49841558 - 49841416
Alignment:
| Q |
159 |
gtttaatgatagtggaattaactaaattaaccattatatcgataactatcgatgtttgaactcttaacgttacaaattaaacttattaaaaaacaatcaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49841558 |
gtttaatgatagtggaattaactaaattaaccattata------actatcgaggtttgaactcttaacgttacaaattaaacttattaaaaaacaatcaa |
49841465 |
T |
|
| Q |
259 |
ctctcgttatcataaacactcatctaccttctcgtcatggaagctcaca |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49841464 |
ctctcgttatcataaacacccatctaccttctcgtcatggaagctcaca |
49841416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University