View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_46 (Length: 274)
Name: NF20016_low_46
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 50386489 - 50386246
Alignment:
| Q |
18 |
agttcctaggctgagtttttctttgagaataatgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386489 |
agttcctaggctgagtttttctttgagaataatgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtct |
50386390 |
T |
 |
| Q |
118 |
atacttatcttgtcaattttgacatccttcttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgagattgaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50386389 |
atacttatcttgtcaattttgacatccttcttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgaaattgaaat |
50386290 |
T |
 |
| Q |
218 |
agttgcatttgttggtgaataggtttttagaggcattgttattc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386289 |
agttgcatttgttggtgaataggtttttagaggcattgttattc |
50386246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University