View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_47 (Length: 273)
Name: NF20016_low_47
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_47 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 73236 - 72991
Alignment:
| Q |
10 |
ataattctcgacagcttgtatcagttgactcctactacgctactactgtcacctttgttgaccggcttctctattatgactcatgattcaattaagggaa |
109 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73236 |
ataattctcgacagtttgtgtcagctgactcctacgacgctactactgtcacctttgttgaccggcttctctattatgactcatgattcaattaagggaa |
73137 |
T |
 |
| Q |
110 |
atgttaacgaggtatcaactttgctgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctg-atctaccacccctaaaagc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
73136 |
atgttaacgaggtatcaactttgctgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctgaagctaccacccctaaaagc |
73037 |
T |
 |
| Q |
209 |
cttggtagcacgaggtatcaatccgaggtcaagagaacaaacgtga |
254 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
73036 |
cttggtagcacgaggtatcaatccaaggtcaacagaacaaacgtga |
72991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 223
Target Start/End: Original strand, 49067680 - 49067770
Alignment:
| Q |
134 |
tgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctg-atctaccacccctaaaagccttggtagcacgagg |
223 |
Q |
| |
|
|||||| ||||||||||||||||| |||| | ||||||||||||||||||||| | ||||||| || |||| |||||||||||||| |
|
|
| T |
49067680 |
tgaaaaatccctcaagaatgacataaaacccggtcaaatcctgcacaactttgctgaagctaccacttctgaaagatttggtagcacgagg |
49067770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University