View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_55 (Length: 257)
Name: NF20016_low_55
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 2182387 - 2182150
Alignment:
| Q |
1 |
tgttggaggtagcataggagggatatcaagtgcacatgcccttatcttagctggttgggatgtccttgtccttgaaaaaaccacctcacctccaactgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2182387 |
tgttggaggtagcataggagggatatcaagtgcacatgcccttatcttagctggttgggatgtccttgtccttgaaaaaaccacctcacctccaactgga |
2182288 |
T |
|
| Q |
101 |
agtcctactggtgcaggtcttggactcaactccttctctcaacaaatcattcaatcttggatttcaaaaccaccacagttcctacacaacaccactcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2182287 |
agtcctactggtgcaggtcttggactcaactccctctctcaacaaatcattcaatcttggatttcaaaaccaccacaattcctacacaacaccactcatc |
2182188 |
T |
|
| Q |
201 |
cactaactattgatcaggtctatttccaccatctcttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2182187 |
cactaactattgatcaggtctatttccaccatctcttt |
2182150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 2184186 - 2184347
Alignment:
| Q |
1 |
tgttggaggtagcataggagggatatcaagtgcacatgcccttatcttagctggttgggatgtccttgtccttgaaaaaaccacctcacctccaactgga |
100 |
Q |
| |
|
|||||| |||||||||| || |||||||||||| |||| |||| ||||| ||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
2184186 |
tgttgggggtagcatagctggtatatcaagtgcaaatgctcttactttagcaggttgggatgttattgttcttgaaaaaaccatttcacctccaactgga |
2184285 |
T |
|
| Q |
101 |
agtcctactggtgcaggtcttggactcaactccttctctcaacaaatcattcaatcttggat |
162 |
Q |
| |
|
| ||| |||||||||||||||| |||||| | |||||||| |||||||||| |||||||| |
|
|
| T |
2184286 |
aatcccactggtgcaggtcttgctctcaaccctctctctcaaaaaatcattcactcttggat |
2184347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University