View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_57 (Length: 253)
Name: NF20016_low_57
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 38994710 - 38994599
Alignment:
| Q |
129 |
gtgattgatacttgagtattagaattttggatagagatttgaaaaagagaggtctgctcttcatcgtttgtgctagaagataatgacaatgaattacatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38994710 |
gtgattgatacttgagtattagaattttggatagagatttgaaaaagagaggtctgctcttcatcgtttgtgctagaagataatgacaatgaattacatt |
38994611 |
T |
|
| Q |
229 |
ttccataccttt |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38994610 |
ttccataccttt |
38994599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 38994838 - 38994758
Alignment:
| Q |
1 |
ataattctgcacactgaatgaatattgtgtaatttatcttttgcgctctttttgtgtctaaatataattcctcctcccccc |
81 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38994838 |
ataattttgcacactgaatgaatattgtgtaatttatcttttgcgctctttttgtgtctaaatataattcctcctcccccc |
38994758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 129 - 240
Target Start/End: Original strand, 2976065 - 2976176
Alignment:
| Q |
129 |
gtgattgatacttgagtattagaattttggatagagatttgaaaaagagaggtctgctcttcatcgtttgtgctagaagataatgacaatgaattacatt |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||| | |||||||||||||||| |||||||| |
|
|
| T |
2976065 |
gtgattgatacttgagtattagagttttggatggagatttgaaaaagagaggtctgctcttcatcttttgtgttggaagataatgacaatggattacatt |
2976164 |
T |
|
| Q |
229 |
ttccataccttt |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2976165 |
ttccataccttt |
2976176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University