View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_60 (Length: 250)
Name: NF20016_low_60
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 49841381 - 49841144
Alignment:
| Q |
2 |
gttcatcgactacaagtcttgtggatagatgggttcaatggaattcttttaatcatagttgcatcgttattaatgttgacttcgtcacccttttaggttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
49841381 |
gttcatcgactacaagtcttgtggatagatgggttcaatggaattcttttaatcatagttgcatcgttattaatgttgactttgtcacccttctaggttt |
49841282 |
T |
 |
| Q |
102 |
tatatctcaggttacattccaggttgatctgacatccttcgtgttgaacttcatgtgagttgccgagagtcgttactgaataagaagttgaactttctaa |
201 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49841281 |
tatatctcaggttacatttcaggtgcatctgacatccttcgtgttgaacttcatgtgatttgccgagagtcgttattgaataagaagttgaactttctaa |
49841182 |
T |
 |
| Q |
202 |
ttgttatttgctacatgcattcccttcattgtattcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49841181 |
ttgttatttgctacatgcattcccttcattgtattcat |
49841144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University