View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_64 (Length: 246)
Name: NF20016_low_64
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 32 - 233
Target Start/End: Original strand, 41981862 - 41982063
Alignment:
| Q |
32 |
tttcaacatttattgaattgtttgaccatctttccattgtatgtgcctagggttttctccggttattattcgagaatcaacaaagactgtacgtagttaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41981862 |
tttcaacatttattgaattgtttgaccatctttccattgtgtgtgcctagggttttctccggttattattcgagaatcaacaaagactgtacgtagttaa |
41981961 |
T |
 |
| Q |
132 |
ttgcaacgtattaattcagccattccctctttgcnnnnnnnnnnnnnnnnnnnntacccatcgtcccttcttctttcttttttggtacaaatcattccct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41981962 |
ttgcaacgtattaattcagccattccctctttgcaaattaaaataaaataaaattacccatcgtcccttcttctttcttttttggtacaaatcattccct |
41982061 |
T |
 |
| Q |
232 |
tc |
233 |
Q |
| |
|
|| |
|
|
| T |
41982062 |
tc |
41982063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University