View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_71 (Length: 236)
Name: NF20016_low_71
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_71 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 38358669 - 38358449
Alignment:
| Q |
16 |
gttcttgtgggagatattgtgtctctcaagattggtgatcaaattccggctgatggagtatttttatccggttattcgttgcaagtggacgaatctagca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38358669 |
gttcttgtgggagatattgtgtctctcaagattggtgatcaaattccggctgatggagtatttttatccggttattcgttgcaagtggacgaatctagca |
38358570 |
T |
 |
| Q |
116 |
tgacaggtgagagcgaccatgtagagattgagcctttaagagctccttttttgttgtccggcgcaaaagttgtggatggatatgctcagatgcttgtaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38358569 |
tgacaggtgagagcgaccatgtagagattgagcctttaagagctccttttttgttgtccggcgcaaaagttgtggatggatatgctcagatgcttgtaac |
38358470 |
T |
 |
| Q |
216 |
atctgtgggcaaaaacacatc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38358469 |
atctgtgggcaaaaacacatc |
38358449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University