View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_72 (Length: 232)
Name: NF20016_low_72
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 36273214 - 36272998
Alignment:
| Q |
1 |
acacgtgagtaattcatctctctcctattcacaacacgtttatcaacatcaattatcttaagaccaaagttattactaccagttgcaattttgtctaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36273214 |
acacgtgagtaattcatctctctcctattcacaacacgtttatcaacatcaattatcttaagaccaaagttattactaccagctgcaattttgtctaatc |
36273115 |
T |
 |
| Q |
101 |
tcttgttgatttgtttaaattttccagtcatcctacaacttgagaagaagtggtttaccttggttatgatcgtattgctgcagctgcgacgcactttgat |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
36273114 |
tcttgttgatttgtttaatttttccagtcatcctacaacttgagaagaagtggtttaccttggttatgatcatattgctgcagctgcgacacactttgat |
36273015 |
T |
 |
| Q |
201 |
tactttcttttgtaagt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36273014 |
tactttcttttgtaagt |
36272998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University