View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_74 (Length: 227)
Name: NF20016_low_74
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 102 - 180
Target Start/End: Complemental strand, 40208948 - 40208870
Alignment:
| Q |
102 |
catgctaatgaaatcaaactcatacagaccagactaactaaatattctcacacttcacatccacatgggcagagtgctt |
180 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208948 |
catgctaattaaatcaaactcatacagaccagactaactaaatattctcacacttcacatccacatgggcagagtgctt |
40208870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 40209050 - 40209016
Alignment:
| Q |
1 |
gattttgatggtcggggaatcatcaaatcatagta |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40209050 |
gattttgatggtcggggaatcatcaaatcatagta |
40209016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University