View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_77 (Length: 216)
Name: NF20016_low_77
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 31296604 - 31296416
Alignment:
| Q |
13 |
cgttaaactcaatcctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatataaattgtgctcttccaacattg |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296604 |
cgttaaactcaaccctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatataaattgtgctcttccaacattg |
31296505 |
T |
|
| Q |
113 |
tttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgtatatcttttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296504 |
tttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgtatatcttttg |
31296416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University