View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20016_low_78 (Length: 212)
Name: NF20016_low_78
Description: NF20016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20016_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 58 - 182
Target Start/End: Complemental strand, 31446765 - 31446641
Alignment:
| Q |
58 |
gagcacaccttcgttcactacttgcctactcagattgcattcttcacttttccgactgcttccaaaattgcatatccgtttaaacaattgtgtcattgga |
157 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||| | ||||||| ||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
31446765 |
gagcacaccttcgttcacaacttgcctattcagattgcattcttcacttttctggctgcttctgaaattgcatatccctttagacaaatgtgtcattgga |
31446666 |
T |
 |
| Q |
158 |
atcctgaagttgttccaatgatctc |
182 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
31446665 |
atcctgacgttgttccaatgatctc |
31446641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 34044207 - 34044293
Alignment:
| Q |
23 |
aatattctttggaaattttttcttctgattcctcagagcacaccttcgttcactacttgcctactcagattgcattcttcacttttc |
109 |
Q |
| |
|
||||||| |||||| |||| |||||| |||| ||||||||||||| | ||||||| ||||| |||| |||||| ||| | |||||| |
|
|
| T |
34044207 |
aatattcattggaatttttctcttcttattctgcagagcacacctttgctcactacatgccttctcatattgcaatctccgcttttc |
34044293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 30423531 - 30423490
Alignment:
| Q |
148 |
tgtcattggaatcctgaagttgttccaatgatctcaccacct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30423531 |
tgtcattggaatcctgaagttgttccaacgatctcaccacct |
30423490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 30428066 - 30428027
Alignment:
| Q |
148 |
tgtcattggaatcctgaagttgttccaatgatctcaccac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30428066 |
tgtcattggaatcctgaagttgttccaacgatctcaccac |
30428027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University