View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20017_high_11 (Length: 354)
Name: NF20017_high_11
Description: NF20017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20017_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 344
Target Start/End: Original strand, 40720125 - 40720451
Alignment:
| Q |
18 |
tgaagaactattggtgaatgagattttggtggtggctatcctatcaaacgttaatgttccatccatcttctcgtttccttggctatccataattaggctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40720125 |
tgaagaactattggtgaatgagattttggtggtggctatcctatcaaacgttaatgttccatccatctcctcgtttccttggctatccataattaggctg |
40720224 |
T |
|
| Q |
118 |
ccaaacctgcttatcaccatctttcccttaacagttgttctaagtccatgaccatctctatgattgggaaggggtcaatattaatattggacatttctta |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| | |
|
|
| T |
40720225 |
ccaaacctgcttatcaccatcttgcccttaacagttgttctaagtccatgaccatctctatgactgggaaggggtcaatattaatattggacctttctga |
40720324 |
T |
|
| Q |
218 |
aacttctttatcgcctaacttgaacctatcttccttgatcaacttttaaacagctctttaaaagatgatgcaattagtcgtggtgtgattataggaattg |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40720325 |
aacttctttatcgcctaacttgaacctgtcttccttgatcaacttttaaacagctctttaaaagatgatgcaattagtcgtggtgtgattataggaattg |
40720424 |
T |
|
| Q |
318 |
tgccagttgacttatctcttgcctttg |
344 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40720425 |
tgccagttgacttatctcttgcctttg |
40720451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University