View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20017_high_19 (Length: 304)
Name: NF20017_high_19
Description: NF20017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20017_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 10 - 239
Target Start/End: Original strand, 29109014 - 29109235
Alignment:
| Q |
10 |
aagaatataattggattaagaatgcaagcaacacaattgtttaaaggcttaaatacaaaagcaacatagttgttcgtacaccttaatgtttggacaaatg |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29109014 |
aagaatataattggattatgaatgcaagcaatacaattgtttaa--------atacaaaagcaacatagttgttcgtacaccttaatgtttggacaaatg |
29109105 |
T |
|
| Q |
110 |
cggtgggttcaaagaggctccgccgcggcatttggctaatgtagcatgctataaattgggtgatttagaatgcgaggaatgaccagaattttaataataa |
209 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29109106 |
cggtgggttcaaagaggctttgccgcggcgtttggctagtgtagcatgctataaattgggtgatttagaatgcaaggaatgaccagaattttaataataa |
29109205 |
T |
|
| Q |
210 |
ggttatggatgtggatgaattggcctctaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29109206 |
ggttatggatgtggatgaattggcctctaa |
29109235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 237 - 288
Target Start/End: Original strand, 29109967 - 29110018
Alignment:
| Q |
237 |
taaaggcccctagtcccccggccactgtttgcatgcttgacttgaatgaaat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29109967 |
taaaggcccctagtcccccggccactgtttgcatgcttgacttgaatgaaat |
29110018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University