View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20017_low_15 (Length: 324)
Name: NF20017_low_15
Description: NF20017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20017_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 42 - 252
Target Start/End: Complemental strand, 34262314 - 34262104
Alignment:
| Q |
42 |
caaaacagagtactctgtttttgtatcattgcatttgctttatcaatgttctatgctaacttttcacattttgtttattctgaatcagtgctattactac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34262314 |
caaaacagagtactctgtttttgtatcattgcatttgctttatcaatgttctatgctaacttttcacattttgtttattctgaatcagtgctattactac |
34262215 |
T |
 |
| Q |
142 |
attgcattgttttctgagaaaaattggaagaaaaaatgaatgctagagcacgctcaactcttcattcaatcaaagtaacttctctttcttctacttctgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34262214 |
attgcattgttttctgagaaaaattggaagaaaaaatgaatgctagagcacgctcaactcttcattcaatcaaagtaacttctcttccttcttcttctgc |
34262115 |
T |
 |
| Q |
242 |
ttcttcaagac |
252 |
Q |
| |
|
||||||||||| |
|
|
| T |
34262114 |
ttcttcaagac |
34262104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University