View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20017_low_20 (Length: 305)
Name: NF20017_low_20
Description: NF20017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20017_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 167
Target Start/End: Original strand, 13864034 - 13864177
Alignment:
| Q |
24 |
gttatagatcaaatttggatttggatatggcggggaattcacctgactctcaccatttcaaccatgactctctcctccgctactgttcttccaacgtttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13864034 |
gttatagatcaaatttggatttggatatggcggggaattcacctgactctcaccatttcaaccatgactctctcctccgctactgttcttccaacgtttc |
13864133 |
T |
|
| Q |
124 |
tggcttccctctttctccaactcatttcaatctctctcaggttc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13864134 |
tggcttccctctttctccaactcatttcaatctctcccaggttc |
13864177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 195 - 287
Target Start/End: Original strand, 13864206 - 13864297
Alignment:
| Q |
195 |
atccatctgggtcatcttcgtttgcatcaaacatttcttctttttgtgtttgannnnnnngaattgttatatagtttggacatggacagtcta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13864206 |
atccatctgggtcatcttcgtttgcatcaaa-atttattctttttgtgtttgatttttttgaattgttatatagtttggacatggacagtcta |
13864297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University