View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20019_high_22 (Length: 267)

Name: NF20019_high_22
Description: NF20019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20019_high_22
NF20019_high_22
[»] chr3 (3 HSPs)
chr3 (18-151)||(6096648-6096780)
chr3 (150-205)||(6096554-6096609)
chr3 (217-257)||(6096490-6096530)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 6096780 - 6096648
Alignment:
18 gtttgtttatagtagatgcttttaattcgaacaattcttcatttgagacataaccaaatggtgagatgggattatcgacttttgatttcaacaaaaatgg 117  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||    
6096780 gtttgtttatagtagatgcttt-aattcgaacaattcttcatttgagacataaccagatggtgagataggattatcgacttttgatttcaacaaaaatgg 6096682  T
118 tccgtttactatgatttttcgtggcagcaacctt 151  Q
    ||||||||||||||||||||||||||||||||||    
6096681 tccgtttactatgatttttcgtggcagcaacctt 6096648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 6096609 - 6096554
Alignment:
150 ttaatgtgatttttagtcaacaatatttaaatggcatccatgcctttcgttactac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
6096609 ttaatgtgatttttagtcaacaatatttaaatggcatccatgcttttcgttactac 6096554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 6096530 - 6096490
Alignment:
217 ataacaaattccacattggaagtagatttgattcccctttg 257  Q
    |||| ||||||||||||||||||||||||||||||||||||    
6096530 ataaaaaattccacattggaagtagatttgattcccctttg 6096490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University