View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20019_high_22 (Length: 267)
Name: NF20019_high_22
Description: NF20019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20019_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 6096780 - 6096648
Alignment:
| Q |
18 |
gtttgtttatagtagatgcttttaattcgaacaattcttcatttgagacataaccaaatggtgagatgggattatcgacttttgatttcaacaaaaatgg |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6096780 |
gtttgtttatagtagatgcttt-aattcgaacaattcttcatttgagacataaccagatggtgagataggattatcgacttttgatttcaacaaaaatgg |
6096682 |
T |
|
| Q |
118 |
tccgtttactatgatttttcgtggcagcaacctt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6096681 |
tccgtttactatgatttttcgtggcagcaacctt |
6096648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 6096609 - 6096554
Alignment:
| Q |
150 |
ttaatgtgatttttagtcaacaatatttaaatggcatccatgcctttcgttactac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6096609 |
ttaatgtgatttttagtcaacaatatttaaatggcatccatgcttttcgttactac |
6096554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 6096530 - 6096490
Alignment:
| Q |
217 |
ataacaaattccacattggaagtagatttgattcccctttg |
257 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6096530 |
ataaaaaattccacattggaagtagatttgattcccctttg |
6096490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University