View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20019_high_25 (Length: 238)
Name: NF20019_high_25
Description: NF20019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20019_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 48289027 - 48289240
Alignment:
| Q |
18 |
acggtataacactaccaatccattggaaatcttttatggctggaagggcatatccatgttgttgatgatcccttgaattgaatcgaatcgaagaagaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289027 |
acggtataacactaccaatccattggaaatcttttatggttggaagggcatatccatgttgttgatgatcccttgaattgaatcgaatcgaagaagaagt |
48289126 |
T |
|
| Q |
118 |
acagagatgtatgtgtgctgctgagcaacacaacagtgtgtattaatgaaaagaaaaggagtgcaccaaaacgacgtatgaagggcagaagttgtgttga |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289127 |
acagagatgtatgtgtgttgctgagcaacacaacagtgtgtattaatgaaaagaaaaggagtacaccaaaacgacgtatgaagggcagaagttgtgttga |
48289226 |
T |
|
| Q |
218 |
gtaatagtggcagt |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48289227 |
gtaatagtggcagt |
48289240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University