View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20019_low_24 (Length: 238)
Name: NF20019_low_24
Description: NF20019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20019_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 42731993 - 42732096
Alignment:
| Q |
18 |
aaatgtaggacttagttcttttccttcttcnnnnnnnaaattttctctttggtttctcatgtaacaaaaaatatatatcttaaccctcatgttttgaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42731993 |
aaatgtaggacttagttcttttccttcttctttttttaaattttctctttggtttctcatgtaacaaaaaatatatatcttaaccctcatgttttgaagt |
42732092 |
T |
|
| Q |
118 |
caat |
121 |
Q |
| |
|
|||| |
|
|
| T |
42732093 |
caat |
42732096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University