View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20020_high_24 (Length: 240)
Name: NF20020_high_24
Description: NF20020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20020_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 119 - 223
Target Start/End: Original strand, 35074281 - 35074385
Alignment:
| Q |
119 |
gtttcttgtagctaccggaagagtgacaaccaaagtggatgtttacgcatttggagtagttttgatggaactgatcacaggtcgaaaggcattagatgat |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074281 |
gtttcttgtagctactggaagagtgacaaccaaagtggatgtttacgcatttggagtagttttgatggaactgatcacaggtcgaaaggcattagatgat |
35074380 |
T |
|
| Q |
219 |
tctgt |
223 |
Q |
| |
|
||||| |
|
|
| T |
35074381 |
tctgt |
35074385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 73
Target Start/End: Original strand, 35074179 - 35074235
Alignment:
| Q |
17 |
taagtgttacattataacatatgcttcattcttgttgcattgtgtgtgattgattcc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074179 |
taagtgttacattataacatatgcttcattcttgttgcattgtgtgtgattgattcc |
35074235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 135 - 218
Target Start/End: Complemental strand, 38159013 - 38158930
Alignment:
| Q |
135 |
ggaagagtgacaaccaaagtggatgtttacgcatttggagtagttttgatggaactgatcacaggtcgaaaggcattagatgat |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| || ||| ||| ||||||||||||| |
|
|
| T |
38159013 |
ggaagagtgacaaccaaagtagatgtttacgcatttggagtagttctgatggaactgattactggtagaagggcattagatgat |
38158930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University