View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20020_low_27 (Length: 240)
Name: NF20020_low_27
Description: NF20020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20020_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 6410343 - 6410133
Alignment:
| Q |
10 |
tatcctttctcccatgtatgacttcacccagtatacgacgctcagtagcagtagtgtctatgtatgctttcactctattgttttctcttcctccnnnnnn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6410343 |
tatcctttctcccatgtatgacttcacccagtatacgacgctcattagcagtagtgtctatgtatgttttcactctattgttttctcttcctcctttttt |
6410244 |
T |
 |
| Q |
110 |
ncgttgaacacatttatagagtatatgaaatggtcttataggtctgtcgttgttcaagcatgtatttattgctcatgggttaaatgtgtatatctgcatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6410243 |
tcgttgaacacatttatagagtatatgaaatggtcttataggtctgtcgttgttcaagcatgtatttattgctcatgggttaaatgtgtatatctgcatg |
6410144 |
T |
 |
| Q |
210 |
tttatgtaact |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
6410143 |
tttatgtaact |
6410133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University