View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20020_low_31 (Length: 202)
Name: NF20020_low_31
Description: NF20020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20020_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 184
Target Start/End: Original strand, 6580190 - 6580356
Alignment:
| Q |
19 |
cacagagaaatttaaaggtaataactatattgatctgcataatgttgttgaagtgtagtttctagcccaggactttccgaacactttatcaagaaggctg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
6580190 |
cacagagaaatttaaaggtaataactatattgatctgcataatgttgttgaagtgtagtttctagcccaggactttccgaacactttgtcaagaagactg |
6580289 |
T |
|
| Q |
119 |
atgatgttgattctattgagaa-ggaaaatagcacagcaatttcgcgatacacgtaacatgagaaag |
184 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6580290 |
atgatgttgattctattgagaagggaaaatagcacagcaatttcgcgatacacgtaacatgagaaag |
6580356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University