View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20020_low_6 (Length: 422)
Name: NF20020_low_6
Description: NF20020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20020_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 1193089 - 1193349
Alignment:
| Q |
1 |
tggccgaaccgtgggaaactatcaccatgtgtttataattctctccggttatttttagaataattatgatctgttttgtttggaaaatgaagagaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1193089 |
tggccgaaccgtgggaaactatcaccatgtgtttataattctctccggttatttttagaatatttatggtctgttttgtttggaaaatgaagagaaagga |
1193188 |
T |
 |
| Q |
101 |
aggaatattcattttacgttactaagagttaatcaactaattaagctttctattactagttaattcatctattttatactaacttatttactacgtacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1193189 |
aggaatattcattttacgttactaagagttaatcaactaattaagctttctattactagttaattcatctattttagactaacttatttac----tacta |
1193284 |
T |
 |
| Q |
201 |
gcatgttttgtcaaaatttgctaatcacttacttaaaatactttacactaaaagagcgagttgct |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1193285 |
gcatgttttgtcaaaatttggtaatcacttacttaaaatacttaacactataagagcgagttgct |
1193349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University