View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20021_low_15 (Length: 316)
Name: NF20021_low_15
Description: NF20021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20021_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 34167142 - 34166833
Alignment:
| Q |
1 |
gcctaggacgcaacattttagtttgtacctttactgatgggtnnnnnnnncacatttatcaggttataatatcatcctaggtttgagtctaagtcgtccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167142 |
gcctaggacgcaacattttagtttgtacctttactgatgggtaaaaaaaacacatttatcaggttataatatcatcctaggtttgagtctaagtcgtccc |
34167043 |
T |
 |
| Q |
101 |
cgacaaactggcttaaatgctgaggattgtctaccctttataagcnnnnnnnnagtccatttctctagtaggatcacgacaaccttctaatttcactcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167042 |
cgacaaactggcttaaatgctgaggattgtctaccctttataagcttttttttagtccatttctctagtaggatcacgacaaccttctaatttcactcaa |
34166943 |
T |
 |
| Q |
201 |
gaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactcttgcattctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34166942 |
gaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactcttgcattctc |
34166843 |
T |
 |
| Q |
301 |
tgttcatctc |
310 |
Q |
| |
|
||||| |||| |
|
|
| T |
34166842 |
tgttcttctc |
34166833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University