View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20022_high_20 (Length: 318)

Name: NF20022_high_20
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20022_high_20
NF20022_high_20
[»] chr5 (1 HSPs)
chr5 (16-81)||(35723979-35724042)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 81
Target Start/End: Original strand, 35723979 - 35724042
Alignment:
16 ataagaaagaaaattaggtaaacacaaactaaaaacaaagaaactcatatatgttggttggcaaaa 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
35723979 ataagaaagaaaattaggtaaacacaaactaaaaacaaagaaactc--atatgttggttggcaaaa 35724042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University