View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20022_high_24 (Length: 281)
Name: NF20022_high_24
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20022_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 22 - 277
Target Start/End: Original strand, 25994088 - 25994343
Alignment:
| Q |
22 |
ccatttcactttctcctctccaacaaattctagaacttgaactcaacaacgacgacgagtggcgcgatgcaaagcgtgactcaaccgaaatgtttttcgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25994088 |
ccatttcactttctcctctccaacaaatcctagaacttgaactcaacaacgacagcgagtggcgcgacgcaaagcgtgactcaaccgaaatgtttttcgg |
25994187 |
T |
 |
| Q |
122 |
tagtgtttacgcactgccgaacaacgtttgggttgttgcattgcggctccacgtcgttgcatgtgaccgcacgaccgcggtgtcacttttgggagagttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25994188 |
cagtgtttacgcactgccgaacaacgtttgggttgttgcattgcggctccacgtcgttgcatgtgaccgcacgaccgcggtgtcacttttgggagagttg |
25994287 |
T |
 |
| Q |
222 |
cttgagctgatggaagaaaaggaagagatccttagtgaagaaaatgataagaaagt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25994288 |
cttgagctgatggaagaaaaggaagagatccttagtgaagaaaatgataagaaagt |
25994343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University