View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20022_high_26 (Length: 253)
Name: NF20022_high_26
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20022_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 51910885 - 51911112
Alignment:
| Q |
16 |
aaaatgattaaattcttcataggagaatttattttttgctgattaatgttacaggattgctgattatgtggtggcaaattcagatcctctgttaccttcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51910885 |
aaaatgattaaattcttcataggagaatttattttttgctgattaatgttacaggattgctgattatgtggtggcaaattcagatcctctgttaccttcg |
51910984 |
T |
 |
| Q |
116 |
taagaaatgttctcatcaatcaatcaatgcttttgttagtttagaagagatcatgaatcttatgtcctttctctttcaagcagaaacaagaagaatcgcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51910985 |
taagaaatgttctcatcaatcaatcaatgcttttgttagtttagaagagatcatgattcttatgtcctttctctttcaagcagaaacaagaagaatcgcc |
51911084 |
T |
 |
| Q |
216 |
ggtcatgtcgcttctggaaatgtctctg |
243 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
51911085 |
ggtcatgtcgcttctggaaatggctctg |
51911112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 64 - 123
Target Start/End: Complemental strand, 18420859 - 18420800
Alignment:
| Q |
64 |
ttacaggattgctgattatgtggtggcaaattcagatcctctgttaccttcgtaagaaat |
123 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
18420859 |
ttacaggattgctgattttgtgatggcaaactcagatcctctgttaccaacgtaagaaat |
18420800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University