View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20022_low_28 (Length: 250)
Name: NF20022_low_28
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20022_low_28 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 96 - 250
Target Start/End: Complemental strand, 33481011 - 33480857
Alignment:
| Q |
96 |
aacacgtctatcgtgaggcaaacaaatttgcaaacgtttttgctatgtttaggttgaataggtctaataggcttagaactttcttcatagttcataagtt |
195 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33481011 |
aacacgtttatcgtgaggcaaacaaatttgcaaacgtttttgctatgtttaggttgaataggtctaataggcttagaactttcttcatagttcataagtt |
33480912 |
T |
|
| Q |
196 |
tacgttttgtgttatgttagtcgataagagcaatgtataaagcttatgtataaaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33480911 |
tacgttttgtgttatgttagtcgataagagcaatgtataaagcttatctataaaa |
33480857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 102
Target Start/End: Complemental strand, 33485234 - 33485145
Alignment:
| Q |
13 |
aatatattcaagatccgccaccgataacataccaaacgatattatatcgatgaacgaaattataaaaattatacacatgatataacacgt |
102 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33485234 |
aatatattcaagatctgccactgataacataccaaacgatattatatcgatgaatgaaattataaaaattatacacatgatataacacgt |
33485145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University