View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20022_low_29 (Length: 250)
Name: NF20022_low_29
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20022_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 118 - 250
Target Start/End: Original strand, 419382 - 419514
Alignment:
| Q |
118 |
ctggaatgcatgctactagttaatagctacacattgcttgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419382 |
ctggaatgcatgctactagttaatagctacacattgctcgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg |
419481 |
T |
 |
| Q |
218 |
tttggtacgacctttgtcgaaaataatccggtg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
419482 |
tttggtacgacctttgtcgaaaataatccggtg |
419514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University