View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20022_low_31 (Length: 239)

Name: NF20022_low_31
Description: NF20022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20022_low_31
NF20022_low_31
[»] chr4 (1 HSPs)
chr4 (16-229)||(33356535-33356748)


Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 33356748 - 33356535
Alignment:
16 agattatccggcgggttgtcgcagtagaagcctttgtagttgcatatatttggaccaacccatgttaaggttattcctaatgggtcatatgttattgtgt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
33356748 agattatccggcgggttgtcgcagtagaagcctttgtagttgcatatatttggaccaacccatgttaaggttattcctaatgggtcagatgttattgtgt 33356649  T
116 ttttgaaggcttgaatgattgggaaaactatagcaagtctttgatctaaaaaatttaagaggtcagggactaatggggataatattggagggagtattgg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33356648 ttttgaaggcttgaatgattgggaaaactatagcaagtctttgatctaaaaaatttaagaggtcagggactaatggggataatattggagggagtattgg 33356549  T
216 ggatattcttggac 229  Q
    ||||| | ||||||    
33356548 ggataatattggac 33356535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University