View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20024_low_18 (Length: 314)
Name: NF20024_low_18
Description: NF20024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20024_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 20 - 300
Target Start/End: Original strand, 33580107 - 33580386
Alignment:
| Q |
20 |
tctaggacatcattttccttccaaggcaaggcaatgcctctgccttttactttagcatagatgttggaggctctcagcttaggccaaaccaacaagcttc |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33580107 |
tctaggacatcattttccttccatggcaaggcaatgcctctgccttttactt-agcatagatgttggaggctctcagcttaggccaaaccaacaagtttc |
33580205 |
T |
|
| Q |
120 |
tcactaacttcccacactttgcgagccttctctacatcacttgcctcctgggatagctggttttcaaatgaagcagaagctttgttccagctccagtaaa |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33580206 |
tcactaacttcccacaccttgcgagccttctctacatcacttgcctcctgggatagctggttttcaaatgaagcagaagctttgttccagctccagtaaa |
33580305 |
T |
|
| Q |
220 |
caccagattttgttaggcttggatcactcacaacctacatttgaaaacaaacaactatacatgagaaatgaagatacttcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33580306 |
caccagattttgttaggcttggatcactcacaacctacatttgaaaacaaacaaccatacatgagaaatgaagatacttcc |
33580386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University